 |
 |
|
|
| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| circRNA8924 | |||
| Gene | n/a | Organism | Human |
| Genome Locus | chr1: 2072008388-207201024:n/a | Build | hg19 |
| Disease | Cervical Cancer | ICD-10 | Malignant neoplasm of cervix uteri (C53) |
| DBLink | Link to database | PMID | 30007986 |
| Experimental Method | |||
| Sample Type | Tissues and Cell lines | Comparison | CC tissues and adjacent normal tissues were collected from 33 cases of patients |
| Method for Estimation | Quantitative PCR | PCR Details | |
| Primers (Experimented) | Forward CAGCTGTGACAGCATGATGA ReverseTCGGGCATCACCCGAAACAA | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
| Citation | |||
| Liu, J, Wang, D, Long, Z, Liu, J, Li, W (2018). CircRNA8924 Promotes Cervical Cancer Cell Proliferation, Migration and Invasion by Competitively Binding to MiR-518d-5p /519-5p Family and Modulating the Expression of CBX8. Cell. Physiol. Biochem., 48, 1:173-184. | |||